Home Print this page Email this page Users Online: 128
Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 

 Table of Contents  
Year : 2018  |  Volume : 6  |  Issue : 1  |  Page : 13-17

ERIC-PCR genotyping of Acinetobacter baumannii isolated from different clinical specimens

1 Department of Microbiology, College of Medicine, Imam Abdulrahman Bin Faisal University, Dammam 31441, Saudi Arabia
2 Department of Clinical Laboratory Science, College of Applied Medical Sciences, Imam Abdulrahman Bin Faisal University, Dammam 31441, Saudi Arabia

Date of Web Publication14-Dec-2017

Correspondence Address:
Nasreldin Elhadi
Department of Clinical Laboratory Science, College of Applied Medical Sciences, Imam Abdulrahman Bin Faisal University, P. O. Box. 2435, Dammam 31441
Saudi Arabia
Login to access the Email id

DOI: 10.4103/sjmms.sjmms_138_16

Rights and Permissions

Background: Acinetobacter baumannii is a major cause of hospital care-acquired infections, and this bacterium poses a significant challenge to health care worldwide. At King Fahd Hospital of the University (KFHU), Al Khobar, Saudi Arabia, there had been a significant increase in the number of cases of A. baumannii infections.
Objective: The objective of this study was to determine the clonal relationship between A. baumannii collected from different specimens of patients admitted to KFHU using the enterobacterial repetitive intergenic consensus–polymerase chain reaction (ERIC-PCR) fingerprinting method.
Materials and Methods: A. baumannii strains were isolated from a total of 59 specimens from inpatients admitted to KFHU between January and September 2014. These specimens were mainly collected from wound, rectal and throat swabs and transtracheal aspiration. ERIC-PCR fingerprinting was used to determine the clonal relationship between the different isolated strains.
Results: Using ERIC-PCR fingerprinting genotype analysis, 51 strains of A. baumannii were clustered into seven groups, while the remaining 8 were single strains. The genetic relatedness of A. baumannii isolated from admitted patients was high, indicating cross-transmission within the hospitalized patients.
Conclusion: This study found that the increase in the incidence of A. baumannii in patients at KFHU was likely due to the spread of seven epidemic clones, thereby highlighting the need for intensifying the infection control measures to prevent nosocomial transmission of A. baumannii. These results also demonstrate that ERIC-PCR is a reliable and rapid method for studying the clonal similarity between A. baumannii isolated from different clinical specimens.

Keywords: Acinetobacter baumannii, clonal relationship, enterobacterial repetitive intergenic consensus-polymerase chain reaction, genetic typing, Saudi Arabia

How to cite this article:
Aljindan R, Alsamman K, Elhadi N. ERIC-PCR genotyping of Acinetobacter baumannii isolated from different clinical specimens. Saudi J Med Med Sci 2018;6:13-7

How to cite this URL:
Aljindan R, Alsamman K, Elhadi N. ERIC-PCR genotyping of Acinetobacter baumannii isolated from different clinical specimens. Saudi J Med Med Sci [serial online] 2018 [cited 2018 Jul 18];6:13-7. Available from: http://www.sjmms.net/text.asp?2018/6/1/13/220794

  Introduction Top

Acinetobacter baumannii is an important Gram-negative coccobacilli classified as an opportunistic bacterial pathogen that is responsible for nearly about 9% of all nosocomial infections.[1] In fact, the Infectious Diseases Society of America has classified A. baumannii as one of the six most important multidrug-resistant microorganisms in hospitals worldwide.[2],[3]A. baumannii is currently believed to be responsible for causing a wide range of severe nosocomial infections, including pneumonia, skin and soft tissue infections, wound infections, urinary tract infections and ventilator- and nosocomial-associated pneumonia, especially among patients in the intensive care unit with high mortality rates.[4],[5],[6],[7],[8],[9] This bacterium is unique because it exhibits resistance against multiple antibiotics. Further, A. baumannii can survive for long periods in hospital environments, enabling its transmission between patients, either through human reservoirs or through inanimate materials.[4],[10],[11]A. baumannii can also persist for long periods in the environmental surfaces of hospitals and can be isolated in hospitals from air, tap water faucets, bedside urinals, gloves, ventilators and angiography catheters.[9],[12]

Molecular typing is becoming a paradigm for understanding the fundamental mechanisms of Acinetobacter infections in hospital settings to investigate the spreading, the clonality relationship among bacterial strains and its geographical spread. In infection control, molecular typing methods are currently an important tool to measure and identify the source of the original infection in hospitals outbreaks. Molecular typing methods have been used to investigate the nosocomial spread of A. baumannii outbreaks in hospital settings worldwide. Some examples of these techniques are plasmid typing, ribotyping, pulsed-field gel electrophoresis (PFGE) and polymerase chain reaction (PCR)-based fingerprinting.[13],[14],[15],[16],[17] As compared with other methods, PCR-based fingerprinting methods are easier to perform and cost effective.

A vast increase in the number of cases of A. baumannii outbreaks had been observed at King Fahd Hospital of the University (KFHU), Al Khobar, Saudi Arabia. These cases were derived from different patient specimens. Accordingly, this study was conducted to investigate the relationship between A. baumannii strains collected from different specimens using enterobacterial repetitive intergenic consensus (ERIC)-PCR DNA fingerprinting. The results of this study would help determine if the increase in the incidence of A. baumannii in patients was due to the spread of epidemic clones as well determine the effectiveness of ERIC-PCR fingerprinting technique for genotyping of A. baumannii.

  Materials and Methods Top

A total of 59 A. baumannii strains were collected from the clinical microbiology laboratory at KFHU between January and September 2014. The 59 strains of A. baumannii were isolated from inpatient specimens: wound swabs (n = 14), transtracheal aspiration (n = 11), rectal swabs (n = 6), throat swabs (n = 5), urine (n = 5), sputum (n = 4), pleural fluid (n = 4), blood (n = 4), intravenous catheter tips (n = 3), nasal swabs (n = 1), skin swabs (n = 1) and abscess specimens (n = 1) [Table 1]. Genomic DNA was prepared using a DNA template extracted using the standard boiling lysis method described elsewhere.[18] A pure, single colony was inoculated in 10 ml of Luria-Bertani broth with 0.5% NaCl (w/v) and the solution was placed in an incubator shaker at 37°C with a rotary speed of 250 rpm for 18 h. The overnight-grown bacterial culture was pelleted and resuspended in a 1.5-ml microcentrifuge tube of sterilized distilled water and boiled in a water bath at 100°C for 15 min. After boiling, the tubes were centrifuged, and 2 μl of the supernatant was used as the DNA template.
Table 1: Distribution of Acinetobacter baumannii strain specimens (n = 59)

Click here to view

The primers used for ERIC-PCR were ERIC-1 (5′ TGTAAGCTCCTGG GGATTCAC 3′) and ERIC-2 (5′ AAGTAAGTGACTGGGGTGAGCG 3′), as described by Coudron et al.[19] The amplification reaction volume was 25 μl, and the cycling conditions were as follows: an initial denaturation at 94°C for 5 min, followed by 35 cycles at 95°C for 1 min, 52°C for 1 min, 72°C for 5 min and a final extension at 72°C for 10 min. The amplified products were resolved through electrophoresis and analyzed on 1.5% agarose gel-stained ethidium bromide. The clonal relatedness between the strains of A. baumannii was analyzed using ERIC-PCR fingerprinting with the BioNumerics fingerprint data software package (Applied Maths, Sint-Martens-Latem, Belgium). Normalization steps were included in the analysis of DNA polymorphism patterns produced by ERIC-PCR fingerprinting to ensure an adequate gel-to-gel banding pattern comparison. The process of band scoring was used to identify bands in each lane that combined to make the fingerprint based on the stringency threshold and optimization settings. Dendrograms were generated for the ERIC-PCR gels using the Dice similarity coefficient and the unweighted pair group method using arithmetic averages, with 1% optimization and 1% position tolerance.[20]A. baumannii strains with a similarity exceeding 90% were considered to be clonally related.

The Institutional Review Board at Imam Abdulrahman Bin Faisal University provided ethical approval for this study (IRB-2017-01-203).

  Results Top

ERIC-PCR fingerprinting grouped A. baumannii strains isolated from different specimens and from the same period of isolation and location [Figure 1]. Among the 59 collected strains of A. baumannii, 51 strains were grouped in 7 clusters (Clusters 1–7) and 8 single isolates were observed at a similarity level of 97% [Figure 2]. Interestingly, within these seven clusters, Clusters 1, 3 and 7 comprised A. baumannii strains isolated from different specimens during the same months (June, July and August); Clusters 2, 4, 5 and 6 comprised A. baumannii strains isolated during the entire course of the study, except in April, in which no strains were islolated.
Figure 1: Representative patterns of Acinetobacter baumannii obtained by enterobacterial repetitive intergenic consensus-polymerase chain reaction, with the numbers indicating the corresponding strains (Lane M is the DNA molecular weight marker)

Click here to view
Figure 2: Dendrogram of enterobacterial repetitive intergenic consensus–polymerase chain reaction using BioNumerics fingerprint data software and unweighted pair group method with arithmetic averages at 97% similarity on 59 strains of Acinetobacter baumannii; the different clusters at 97% similarity are arbitrarily designated as Clusters 1–7, of which Clusters 2 and 6 are the largest group representing the most prevalent clone of A. baumannii and its variants among the isolates

Click here to view

  Discussion Top

A. baumannii is one of the emerging nosocomially acquired pathogens and is responsible for different types of infections, ranging from minor soft tissue infections to more severe infections such as ventilator-associated pneumonia and bacteremia.[16] Bacterial genomes containing repeat sequences such as the ERIC sequence can be used as molecular biological tools to assess the clonal variability of many bacterial isolates.[21],[22] ERIC-PCR fingerprinting is one of the fastest molecular typing techniques to differentiate between A. baumannii and other strains of Gram-negative bacteria responsible for hospital-acquired infections.[9],[19],[23],[24],[25] The findings of this study are similar to that of studies reported by Ying et al. and Hammoudi et al., who were also able to cluster A. baumannii strains based on their genetic relatedness using ERIC-PCR.[9],[25]

The results of this study indicate an influence of epidemiological relatedness on the clustering of A. baumannii strains, as seven clusters of A. baumannii strains with high relatedness were recovered from the same period of isolation and location [Figure 2]. This indicates that there was cross-transmission within hospitalized patients. Based on our results, it can be stated that ERIC-PCR is a reliable method to demonstrate the clonal relatedness between A. baumannii recovered from different specimens isolated from different inpatients.

Another interesting result found in this study was that Clusters 1, 3 and 7 were only, although highly, prevalent during June–August, whereas Clusters 2, 4, 5 and 6 were prevalent during the entire course of the study. This difference in prevalence patterns between clusters could be because the strains in Clusters 1, 3 and 7 are either only prevalent during those months or that there had been an outbreak of these strains. However, further analyses are required to validate these differences in prevalence patterns.

The results of this study revealed that ERIC-PCR is a reliable technique for discriminating intraspecific variations. In addition, according to the authors, ERIC-PCR is a very convenient and fast method, thereby making using it advantageous compared with other PCR- and non-PCR-based fingerprinting such as PFGE for A. baumannii. Further, the obtained ERIC patterns exhibited a high genetic similarity, ranging from 91% to 99%, and generated a larger number of DNA fingerprints among the strains of A. baumannii. Therefore, this PCR-based target repetitive element method is more suitable than rapid typing, in addition to this method being more cost effective than other DNA fingerprint methods.[9]

  Conclusion Top

Using ERIC-PCR, this study demonstrated a high level of genetic similarity and relationship among the strains of A. baumannii isolated from different clinical specimens at KFHU, Al-Khobar, Saudi Arabia. This highlights the need for intensifying infection control measures to prevent nosocomial transmission of A. baumannii at KFHU. Our study also found that ERIC-PCR fingerprinting exhibits an excellent discriminatory capability of A. baumannii strains.

Financial support and sponsorship

This work was supported by Grant no. 2013203 from the Deanship of Scientific Research at Imam Abdulrahman Bin Faisal University, Dammam, Saudi Arabia.

Conflicts of interest

There are no conflicts of interest.

  References Top

Joly-Guillou ML. Clinical impact and pathogenicity of Acinetobacter. Clin Microbiol Infect 2005;11:868-73.  Back to cited text no. 1
Talbot GH, Bradley J, Edwards JE Jr., Gilbert D, Scheld M, Bartlett JG, et al. Bad bugs need drugs: An update on the development pipeline from the antimicrobial Availability Task Force of the Infectious Diseases Society of America. Clin Infect Dis 2006;42:657-68.  Back to cited text no. 2
Antunes LC, Visca P, Towner KJ. Acinetobacter baumannii: Evolution of a global pathogen. Pathog Dis 2014;71:292-301.  Back to cited text no. 3
Bergogne-Bérézin E, Towner KJ. Acinetobacter spp. As nosocomial pathogens: Microbiological, clinical, and epidemiological features. Clin Microbiol Rev 1996;9:148-65.  Back to cited text no. 4
Villari P, Iacuzio L, Vozzella EA, Bosco U. Unusual genetic heterogeneity of Acinetobacter baumannii isolates in a university hospital in Italy. Am J Infect Control 1999;27:247-53.  Back to cited text no. 5
Smolyakov R, Borer A, Riesenberg K, Schlaeffer F, Alkan M, Porath A, et al. Nosocomial multi-drug resistant Acinetobacter baumannii bloodstream infection: Risk factors and outcome with ampicillin-sulbactam treatment. J Hosp Infect 2003;54:32-8.  Back to cited text no. 6
Abbott I, Cerqueira GM, Bhuiyan S, Peleg AY. Carbapenem resistance in Acinetobacter baumannii: Laboratory challenges, mechanistic insights and therapeutic strategies. Expert Rev Anti Infect Ther 2013;11:395-409.  Back to cited text no. 7
McConnell MJ, Actis L, Pachón J. Acinetobacter baumannii: Human infections, factors contributing to pathogenesis and animal models. FEMS Microbiol Rev 2013;37:130-55.  Back to cited text no. 8
Ying C, Li Y, Wang Y, Zheng B, Yang C. Investigation of the molecular epidemiology of Acinetobacter baumannii isolated from patients and environmental contamination. J Antibiot (Tokyo) 2015;68:562-7.  Back to cited text no. 9
Aygün G, Demirkiran O, Utku T, Mete B, Urkmez S, Yilmaz M, et al. Environmental contamination during a carbapenem-resistant Acinetobacter baumannii outbreak in an Intensive Care Unit. J Hosp Infect 2002;52:259-62.  Back to cited text no. 10
Russotto V, Cortegiani A, Raineri SM, Giarratano A. Bacterial contamination of inanimate surfaces and equipment in the Intensive Care Unit. J Intensive Care 2015;3:54.  Back to cited text no. 11
Dijkshoorn L, Aucken HM, Gerner-Smidt P, Kaufmann ME, Ursing J, Pitt TL, et al. Correlation of typing methods for Acinetobacter isolates from hospital outbreaks. J Clin Microbiol 1993;31:702-5.  Back to cited text no. 12
Gräser Y, Klare I, Halle E, Gantenberg R, Buchholz P, Jacobi HD, et al. Epidemiological study of an Acinetobacter baumannii outbreak by using polymerase chain reaction fingerprinting. J Clin Microbiol 1993;31:2417-20.  Back to cited text no. 13
Vila J, Marcos MA, Jimenez de Anta MT. A comparative study of different PCR-based DNA fingerprinting techniques for typing of the Acinetobacter calcoaceticus-A. Baumannii complex. J Med Microbiol 1996;44:482-9.  Back to cited text no. 14
Rafei R, Kempf M, Eveillard M, Dabboussi F, Hamze M, Joly-Guillou ML, et al. Current molecular methods in epidemiological typing of Acinetobacter baumannii. Future Microbiol 2014;9:1179-94.  Back to cited text no. 15
Biswas I. Genetic tools for manipulating Acinetobacter baumannii genome: An overview. J Med Microbiol 2015;64:657-69.  Back to cited text no. 16
Ahmed SS, Alp E. Genotyping methods for monitoring the epidemic evolution of A. Baumannii strains. J Infect Dev Ctries 2015;9:347-54.  Back to cited text no. 17
Elhadi N, Alsamman K. Incidence and antimicrobial susceptibility pattern of extended-spectrum-β-lactamase-producing Escherichia coli isolated from retail imported mackerel fish. Afr J Biotechnol 2015;14:1954-60.  Back to cited text no. 18
Coudron PE, Moland ES, Thomson KS. Occurrence and detection of AmpC beta-lactamases among Escherichia coli, Klebsiella pneumoniae, and Proteus mirabilis isolates at a veterans medical center. J Clin Microbiol 2000;38:1791-6.  Back to cited text no. 19
Sneath PH, Sokal RR. Numerical Taxonomy: The Principles and Practice of Numerical Classification. San Francisco, CA: W. H. Freeman; 1973.  Back to cited text no. 20
Versalovic J, Koeuth T, Lupski JR. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res 1991;19:6823-31.  Back to cited text no. 21
Dalla-Costa LM, Irino K, Rodrigues J, Rivera IN, Trabulsi LR. Characterisation of diarrhoeagenic Escherichia coli clones by ribotyping and ERIC-PCR. J Med Microbiol 1998;47:227-34.  Back to cited text no. 22
Peleg AY, Hooper DC. Hospital-acquired infections due to gram-negative bacteria. N Engl J Med 2010;362:1804-13.  Back to cited text no. 23
Ramirez MS, Traglia GM, Lin DL, Tran T, Tolmasky ME. Plasmid-mediated antibiotic resistance and virulence in gram-negatives: The Klebsiella pneumoniae paradigm. Microbiol Spectr 2014;2:1-5.  Back to cited text no. 24
Hammoudi D, Moubareck CA, Hakime N, Houmani M, Barakat A, Najjar Z, et al. Spread of imipenem-resistant Acinetobacter baumannii co-expressing OXA-23 and GES-11 carbapenemases in Lebanon. Int J Infect Dis 2015;36:56-61.  Back to cited text no. 25


  [Figure 1], [Figure 2]

  [Table 1]


Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

  In this article
   Materials and Me...
   Article Figures
   Article Tables

 Article Access Statistics
    PDF Downloaded161    
    Comments [Add]    

Recommend this journal
